Prev. | 

RIKEN DNA Bank Human Resource - USB1

Gene ID NCBI Gene 79650 |  KEGG hsa:79650
Gene Symbol USB1
Protein Name U6 snRNA biogenesis phosphodiesterase 1
Synonyms C16orf57|HVSL1|Mpn1|PN|hUsb1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085436 IRAL013J20 pOTB7 BC004415 NM_024598 Full
HGY086186 IRAL015H18 pOTB7 BC006291 NM_024598 Full
HGY087116 IRAL017N04 pOTB7 BC007774 NM_024598 Full
HGY096085 IRAL040D13 pOTB7 BC021554 NM_024598 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078404 ARe96A04 pKA1U5 NM_024598.2  
GAGCGGAACTCCGGGTGCCGGTTGAGGTTGCTGGTGGACCTGCTCTGGTGGTCTTGGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl