Prev. | 

RIKEN DNA Bank Human Resource - AKIRIN1

Gene ID NCBI Gene 79647 |  KEGG hsa:79647
Gene Symbol AKIRIN1
Protein Name akirin 1
Synonyms C1orf108|STRF2
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044476 ARe11D04 pKA1U5 NM_024595.2  
GCGGGTGCTGGAGGCGCCATTGGAGCCGGCTTGCGCTGGCGAGCCCGGCTGAGGAGCCTC
HKR070007 ARe75A07 pKA1U5 NM_024595.2  
GGCTGGAGGCGCCATTGGAGCCGGCTTGGCTGNCGANTCCCGGCTGAGGAGCCTCTTGGG
HKR072927 ARe82F07 pKA1U5 NM_024595.2  
GGGCGAGCCCGGCTGAGGAGCCTCTTGGGCCGCACTTACTGCCGCGTCCGCTCCCGGTCC
HKR219865 ARiS049L01 pGCAP10 NM_024595.2  
GGCCGTTGGAGCCGGCTTGGNTGGCGANCCCGGCTGAGGANCCTCTTGGGCCGCNCTTAC
HKR398126 RBd95F06 pGCAP10 NM_024595.2  
GGGCTTGGCTGGCGAGCCCGGCTGAGGAGCCTCTTGGGCCGCACTTACTGCCGCGTCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl