Prev. |  KEGG KO K12345 > 

RIKEN DNA Bank Human Resource - SRD5A3

Gene ID NCBI Gene 79644 |  KEGG hsa:79644
Gene Symbol SRD5A3
Protein Name steroid 5 alpha-reductase 3
Synonyms CDG1P|CDG1Q|KRIZI|SRD5A2L|SRD5A2L1
Ortholog resource in our bank

  SRD5A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082288 IRAL005L24 pOTB7 BC002480 NM_024592 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE107224 M01C068A24 pDONR221 06_08-F12 BC002480 NM_024592  
HGE107272 M01C068C24 pDONR221 06_08-F12 BC002480 NM_024592  
HGE107320 M01C068E24 pDONR221 06_08-F12 BC002480 NM_024592  
HGE124806 M01C112A06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE124854 M01C112C06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE124902 M01C112E06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE124950 M01C112G06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE124998 M01C112I06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE125046 M01C112K06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE125094 M01C112M06 pDONR221 06-2_04-F03 BC002480 NM_024592  
HGE125142 M01C112O06 pDONR221 06-2_04-F03 BC002480 NM_024592  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005698 W01A014E02 pENTR-TOPO IRAL005L24 BC002480 NM_024592  
HGE005700 W01A014E04 pENTR-TOPO IRAL005L24 BC002480 NM_024592  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179770 ARi49H02 pGCAP10 NM_024592.3  
GGGGCGCCAGCAGCGCGGAAGGGGGGCACGCGGGCCATGGCTCCCTGGGCGGAGGCCGAG
HKR453106 RBdS132M18 pGCAP10 NM_024592.3  
GAGCAGCGCGGAAGGCGGGCACGCGGGCCATGGCTCCCTGGGCGGAGGCCGAGCACTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl