Prev. | 

RIKEN DNA Bank Human Resource - ARMT1

Gene ID NCBI Gene 79624 |  KEGG hsa:79624
Gene Symbol ARMT1
Protein Name acidic residue methyltransferase 1
Synonyms C6orf211
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005162 IRAK012P02 pCMV-SPORT6 BC011348 NM_024573 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405810 RBdS014I18 pGCAP10 NM_024573.1  
TGGTTTCTGCGGCGATTGAACAGCCGAGCTTTGCGGCCGGGATCGCGGAAAGTGATGGCT
HKR461920 RBdS154N08 pGCAP10 NM_024573.1  
GGATGTCCTTTTGTGTCCTACAAGCNCCCGGCGGCGCCGCCNAGTGAGGGGACNCNGCNC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl