Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GALNT14

Gene ID (NCBI) 79623
Gene Symbol GALNT14
Protein Name UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Synonyms GALNT15|GalNac-T10|GalNac-T14
Databases KEGG link 01 |  NCBI Gene link 01

Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005554 IRAK013O18 pCMV-SPORT6 BC010659 NM_024572 Full
HGY086331 IRAL015N19 pOTB7 BC006269 NM_024572 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv

NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR388434 RBd71B10 pGCAP10 NM_024572.2
CGGCCGGCCGATGCCCGCCCCGCCTTGCCCCAACCCACGATGGTCTGGGAGCTGCGCCCA
HKR396884 RBd92D12 pGCAP10 NM_024572.2
TGAGGGGACCATGCGGCGCCTGACTCGTCGGCTGGTTCTGCCAGTCTTCGGGGTGCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv

2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl