Prev. |  KEGG KO K00710 > 

RIKEN DNA Bank Human Resource - GALNT14

Gene ID NCBI Gene 79623 |  KEGG hsa:79623
Gene Symbol GALNT14
Protein Name polypeptide N-acetylgalactosaminyltransferase 14
Synonyms GALNT15|GalNac-T10|GalNac-T14
Ortholog resource in our bank

  GALNT14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005554 IRAK013O18 pCMV-SPORT6 BC010659 NM_024572 Full
HGY086331 IRAL015N19 pOTB7 BC006269 NM_024572 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388434 RBd71B10 pGCAP10 NM_024572.2  
CGGCCGGCCGATGCCCGCCCCGCCTTGCCCCAACCCACGATGGTCTGGGAGCTGCGCCCA
HKR396884 RBd92D12 pGCAP10 NM_024572.2  
TGAGGGGACCATGCGGCGCCTGACTCGTCGGCTGGTTCTGCCAGTCTTCGGGGTGCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl