Prev. | 

RIKEN DNA Bank Human Resource - FAM118B

Gene ID NCBI Gene 79607 |  KEGG hsa:79607
Gene Symbol FAM118B
Protein Name family with sequence similarity 118 member B
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001780 IRAK004H12 pCMV-SPORT6 BC001340 NM_024556 Full
HGY080851 IRAL002C03 pOTB7 BC001647 NM_024556 Full
HGY083891 IRAL009M03 pOTB7 BC001647 NM_024556 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170832 ARi27B08 pGCAP10 NM_024556.2  
GGGTAGCTGCAGCTGGAGCAGTGGCGTTTGGAGGAGACTCGAAACTGGATGGCTTCTACA
HKR172852 ARi32C04 pGCAP10 NM_024556.2  
GGGTATCTGCAGCTGGAGCAGTGGCGTTTGGAGGAGACTCGAAACTGGATGGCTTCTACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl