Prev. |  KEGG KO K16717 > 

RIKEN DNA Bank Human Resource - CEP97

Gene ID NCBI Gene 79598 |  KEGG hsa:79598
Gene Symbol CEP97
Protein Name centrosomal protein 97
Synonyms 2810403B08Rik|LRRIQ2
Ortholog resource in our bank

  CEP97

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027810 IRAK069I18 pCMV-SPORT6 BC041085 NM_024548

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE108014 M01C070A14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108062 M01C070C14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108110 M01C070E14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108158 M01C070G14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108206 M01C070I14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108254 M01C070K14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108302 M01C070M14 pDONR221 06_09-F07 AK093100 ENST00000327230  
HGE108350 M01C070O14 pDONR221 06_09-F07 AK093100 ENST00000327230  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168881 ARi22D09 pGCAP10 NM_024548.2  
CGGCCGGCCGATGAAGCTCCACAGAGCCGCGGGAGGACGGTTGCCTGGTATTATTAGCAA
HKR369676 RBd24D04 pGCAP10 NM_024548.2  
GAGGACGGTTGCCTGGTATTATTAGCAAGCAGCAAATATGGCGGTGGCGCGCGTGGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl