Prev. |  KEGG KO K02895 > 

RIKEN DNA Bank Human Resource - MRPL24

Gene ID NCBI Gene 79590 |  KEGG hsa:79590
Gene Symbol MRPL24
Protein Name mitochondrial ribosomal protein L24
Synonyms L24mt|MRP-L18|MRP-L24
Ortholog resource in our bank

  MRPL24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008570 IRAK021H02 pCMV-SPORT6 BC012440 NM_145729 Full
HGY092844 IRAL032B20 pDNR-LIB BC016700 NM_145729 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068836 ARe72B12 pKA1U5 NM_024540.3  
GATGTGCTGAAAATCCGAAGTGCCGCGGAAAGTGGAGGTGAGGGCCGCCCGCCCTAGAGG
HKR348428 RBb71B04 pGCAP1 NM_024540.3  
GATGTGCTGAAAATCCGAAGTGCCGCGGAAAGTGGAGGTGAGGGCCGCCCGCCCTAGAGG
HKR388521 RBd71F01 pGCAP10 NM_024540.3  
GCAGAAAGTCGACGGGCGTGGCGGGGGAGGGGACGCTGAGGGCCCATGTGCTGAAAATCC
HKR396049 RBd90C01 pGCAP10 NM_024540.3  
GATGTGCTGAAAATCCGAAGTGCCGCGGAAAGTGGAGGTGAGGGCCGCCCGCCCTAGAGG
HKR442139 RBdS105F19 pGCAP10 NM_024540.3  
CGGCCGGCCGATGACAGCTAGGCCTTGGCGATGTCTGGGATGAGGCTGGTGGGGGAAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl