Prev. |  KEGG KO K00747 > 

RIKEN DNA Bank Human Resource - CHPF

Gene ID NCBI Gene 79586 |  KEGG hsa:79586
Gene Symbol CHPF
Protein Name chondroitin polymerizing factor
Synonyms CHSY2|CSS2
Ortholog resource in our bank

  CHPF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086976 IRAL017H08 pOTB7 BC021223 NM_024536 Full
HGY088079 IRAL020D07 pOTB7 BC023531 NM_024536
HGY090711 IRAL026M23 pOTB7 BC008878 NM_024536 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081233 M01C003B09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081281 M01C003D09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081329 M01C003F09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081377 M01C003H09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081425 M01C003J09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081473 M01C003L09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081521 M01C003N09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE081569 M01C003P09 pDONR221 04-134-2_2-C05 BC021223 ENST00000373891  
HGE098803 M01C047A03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE098851 M01C047C03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE098899 M01C047E03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE098947 M01C047G03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE098995 M01C047I03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE099043 M01C047K03 pDONR221 MGC13-A02 BC021223 ENST00000373891  
HGE099091 M01C047M03 pDONR221 MGC13-A02 BC021223 ENST00000373891  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061697 ARe54E01 pKA1U5 NM_024536.5  
GGGGGCCGGGGTACCCGCGGTCCGGGCGCCATGCCNNTNATNGCTGCTGCTGTCGGTGCT
HKR080880 ARf02D08 pKA1U5 NM_024536.5  
GGCCGGGGACCCGCGGTCCGGGCGCCATGCGGGCATCGCTGCTGCTGTCGGTGCTGCGGC
HKR168478 ARi21D06 pGCAP10 NM_024536.5  
TGGTCCCGCCCCCTCGGAGACTCCTCTGGCTGCTCTGGGGGTTCNCCGGGGCCGGGGACC
HKR276566 ARiS191G22 pGCAP10 NM_024536.5  
GAGGCTCCAGTGCCGAGCGCAAGAACCCTGCGCAGCCCAGAGCAGCTGCTGGAGGGGAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl