Prev. |  KEGG KO K22117 > 

RIKEN DNA Bank Human Resource - SLC52A2

Gene ID NCBI Gene 79581 |  KEGG hsa:79581
Gene Symbol SLC52A2
Protein Name solute carrier family 52 member 2
Synonyms BVVLS2|D15Ertd747e|GPCR41|GPR172A|PAR1|RFT3|RFVT2|hRFT3
Ortholog resource in our bank

  SLC52A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086060 IRAL015C12 pOTB7 BC002917 NM_024531 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042005 W01A105A05 pENTR-TOPO flj0029d17 AK021918 NM_024531  
HGE042009 W01A105A09 pENTR-TOPO flj0029d17 AK021918 NM_024531  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050507 ARe26E11 pKA1U5 NM_024531.3  
GGGGGCCCGGAACCGCCACGGCTAGAAGAAGTCTTCACTTCCCAGGAGAGCCAAAGCGTG
HKR068009 ARe70A09 pKA1U5 NM_024531.3  
GAGTCGGGTCGTGGCTGCTGCCGGGTGCTGCGCGCTCCGGACTGAGGTGGCGTCCCTGGG
HKR381649 RBd54C01 pGCAP10 NM_024531.3  
GGTGGGCCATGCCGGGGGCGGGCCCGGAACCGCCACGGCTAGAAGAAGTCTTCACTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl