Prev. |  KEGG KO K15175 > 

RIKEN DNA Bank Human Resource - CDC73

Gene ID NCBI Gene 79577 |  KEGG hsa:79577
Gene Symbol CDC73
Protein Name cell division cycle 73
Synonyms C1orf28|FIHP|HPTJT|HRPT1|HRPT2|HYX
Ortholog resource in our bank

  CDC73

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007627 IRAK019B03 pCMV-SPORT6 BC013075 NM_024529 Partial/var
HGX056377 IRAK140P17 pCMV-SPORT6 BC065037 NM_024529 Full
HGY089626 IRAL024B02 pOTB7 BC007325 NM_024529 Partial/var
HGY092413 IRAL031A13 pDNR-LIB BC014351 NM_024529 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE049549 W01A123O13 pENTR-TOPO IRAK140P17 BC065037 NM_024529  
HGE049557 W01A123O21 pENTR-TOPO IRAK140P17 BC065037 NM_024529  
HGE049559 W01A123O23 pENTR-TOPO IRAK140P17 BC065037 NM_024529  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124527 ARh11F07 pGCAP1 NM_024529.3  
GAGGCGCGGCGGCAGCGGCGGCGCCCCGAGCCGGCGGAGGCGAGGGGGGGGAAGATGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl