Prev. |  KEGG KO K13701 > 

RIKEN DNA Bank Human Resource - ABHD8

Gene ID NCBI Gene 79575 |  KEGG hsa:79575
Gene Symbol ABHD8
Protein Name abhydrolase domain containing 8
Synonyms -
Ortholog resource in our bank

  ABHD8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005335 IRAK013F15 pCMV-SPORT6 BC011536 NM_024527 Partial
HGX021064 IRAK052K24 pCMV-SPORT6 BC039087 NM_024527 Full/var
HGY083496 IRAL008M08 pOTB7 BC020173 NM_024527 Full/var
HGY088171 IRAL020H03 pOTB7 BC007895 NM_024527 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363660 RBd09C12 pGCAP10 NM_024527.4  
GGGCCGCGGGATGCCCCTGCGCTGACCGCCAGGGGCAGGTGCCCGCCCGCGTAGACGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl