Prev. |  KEGG KO K14973 > 

RIKEN DNA Bank Human Resource - PAGR1

Gene ID NCBI Gene 79447 |  KEGG hsa:79447
Gene Symbol PAGR1
Protein Name PAXIP1 associated glutamate rich protein 1
Synonyms C16orf53|GAS|PA1
Ortholog resource in our bank

  PAGR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084595 IRAL011I03 pOTB7 BC003640 NM_024516

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004884 W01A012D12 pENTR-TOPO IRAL011I03 BC003640 NM_024516  
HGE004888 W01A012D16 pENTR-TOPO IRAL011I03 BC003640 NM_024516  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065256 ARe63C08 pKA1U5 NM_024516.3  
GGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGCTCCCTGCCCTAGTGGCCTATGTCCCT
HKR078172 ARe95H04 pKA1U5 NM_024516.3  
GGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGNTCCGGGTGTGGAGAGGGGCGTC
HKR176575 ARi41H07 pGCAP10 NM_024516.3  
GATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl