Prev. | 

RIKEN DNA Bank Human Resource - CYBC1

Gene ID NCBI Gene 79415 |  KEGG hsa:79415
Gene Symbol CYBC1
Protein Name cytochrome b-245 chaperone 1
Synonyms C17orf62|Eros
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080929 IRAL002F09 pOTB7 BC004171 NM_001033046 Full
HGY083837 IRAL009J21 pOTB7 BC003595 NM_001033046 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065235 ARe63B11 pKA1U5 NM_001033046.2  
GCTCTCTGCTGCGGCGCGGGGACCGCTGTGCTCTCGACCCCTCCTCCTGTAGAGAGTGGT
HKR222254 ARiS055K14 pGCAP10 NM_001033046.2  
CGGCCGGCCGATGGGTTCGCGTCTCTCTGCTGCGGCGCGGGGACCGCTGTGCTCTCGACC
HKR405615 RBdS014A15 pGCAP10 NM_001033046.2  
GGCCGGTTCGCGTCTCTCTGCTGCGGCGCGGGGACCGCTGTGCTCTCGACCCCTCCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl