Prev. |  KEGG KO K13175 > 

RIKEN DNA Bank Human Resource - THOC6

Gene ID NCBI Gene 79228 |  KEGG hsa:79228
Gene Symbol THOC6
Protein Name THO complex 6
Synonyms WDR58|fSAP35
Ortholog resource in our bank

  THOC6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044210 IRAK110I18 pCMV-SPORT6 BC050674 NM_024339
HGY083237 IRAL008B13 pOTB7 BC003118 NM_024339 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074060 ARe85C12 pKA1U5 NM_024339.3  
GGCGCGGGCGCGGAAGACGGGCGGCGCGATGGCGGAAGGCAGGCTTGCTCCTCGGGGTGG
HKR320454 RBb01C06 pKA1U5 NM_024339.3  
GAATACGGGCGGCGCGTGGCNGAAGGTAGGCTTGCTCCTCGGCGGTGGGGGAGGGCNTCN
HKR367277 RBd18D05 pGCAP10 NM_024339.3  
GGCGAGGTTCTGCGCGGGCGCGGAAGACGGGCGGCGCGTGGCGGAAGGCAGGCTTGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl