Prev. |  KEGG KO K11864 > 

RIKEN DNA Bank Human Resource - BRCC3

Gene ID NCBI Gene 79184 |  KEGG hsa:79184
Gene Symbol BRCC3
Protein Name BRCA1/BRCA2-containing complex subunit 3
Synonyms BRCC36|C6.1A|CXorf53
Ortholog resource in our bank

  BRCC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081113 IRAL002N01 pOTB7 BC006540 -
HGY083637 IRAL009B13 pOTB7 BC002999 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014453 W01A036C05 pENTR-TOPO IRAL002N01 BC006540 -  
HGE014455 W01A036C07 pENTR-TOPO IRAL002N01 BC006540 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222067 ARiS055C19 pGCAP10 NM_024332.2  
GGAGAAGGGTCGGGCCAAGATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCT
HKR399649 RBd99C01 pGCAP10 NM_024332.2  
GGCACAGCGCTGGGCGCTGGGGAGGCTGCGCCGCAGCACCCGGTTGGTCAGGACCAAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl