Prev. |  KEGG KO K10281 > 

RIKEN DNA Bank Human Resource - FBXL15

Gene ID NCBI Gene 79176 |  KEGG hsa:79176
Gene Symbol FBXL15
Protein Name F-box and leucine rich repeat protein 15
Synonyms FBXO37|Fbl15|JET|PSD
Ortholog resources KEGG ortholog (KEGG orthology K10281) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086357 IRAL015O21 pOTB7 BC002912 NM_024326.3

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098436 M01C046B12 pDONR221 MGC12-H06 BC002912  
HGE098484 M01C046D12 pDONR221 MGC12-H06 BC002912  
HGE098532 M01C046F12 pDONR221 MGC12-H06 BC002912  
HGE098580 M01C046H12 pDONR221 MGC12-H06 BC002912  
HGE098628 M01C046J12 pDONR221 MGC12-H06 BC002912  
HGE098676 M01C046L12 pDONR221 MGC12-H06 BC002912  
HGE098724 M01C046N12 pDONR221 MGC12-H06 BC002912  
HGE098772 M01C046P12 pDONR221 MGC12-H06 BC002912  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043350 ARe08G06 pKA1U5 NM_024326.3  
TGGGGAGCCGAGCCGGGGCTGGGTCTGGGGGCCGCTCTTGGGAGCTGGGGCGCAGGAACA
HKR339331 RBb48F11 pGCAP1 NM_024326.3  
GGCCGGGAGGTGGTGCGCGCTCACGNTGGCTCTATCTTTGCAGGGGTCTGTCCTCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl