Prev. | 

RIKEN DNA Bank Human Resource - CRELD2

Gene ID NCBI Gene 79174 |  KEGG hsa:79174
Gene Symbol CRELD2
Protein Name cysteine rich with EGF like domains 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044213 IRAK110I21 pCMV-SPORT6 BC050675 NM_024324
HGY086249 IRAL015K09 pOTB7 BC002894 NM_024324 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081231 M01C003B07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081279 M01C003D07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081327 M01C003F07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081375 M01C003H07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081423 M01C003J07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081471 M01C003L07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081519 M01C003N07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE081567 M01C003P07 pDONR221 04-134-2_2-C04 BC002894 ENST00000341118  
HGE110420 M01C076A20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110468 M01C076C20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110516 M01C076E20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110564 M01C076G20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110612 M01C076I20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110660 M01C076K20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110708 M01C076M20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE110756 M01C076O20 pDONR221 06-2_01-F10 BC002894 ENST00000341118  
HGE098441 M01C046B17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098489 M01C046D17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098537 M01C046F17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098585 M01C046H17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098633 M01C046J17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098681 M01C046L17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098729 M01C046N17 pDONR221 MGC12-G09 BC002894 ENST00000341118  
HGE098777 M01C046P17 pDONR221 MGC12-G09 BC002894 ENST00000341118  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347703 RBb69E07 pGCAP1 NM_024324.2  
GGGGAGCGGGTGGGCGGCCGGGAGGCCGGAGCAGCACGGCCGCAGGACCTGGAGCTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl