Prev. | 

RIKEN DNA Bank Human Resource - RBM42

Gene ID NCBI Gene 79171 |  KEGG hsa:79171
Gene Symbol RBM42
Protein Name RNA binding motif protein 42
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084631 IRAL011J15 pOTB7 BC004204 NM_024321
HGY086059 IRAL015C11 pOTB7 BC002868 NM_024321 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098018 M01C045A18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098066 M01C045C18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098114 M01C045E18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098162 M01C045G18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098210 M01C045I18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098258 M01C045K18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098306 M01C045M18 pDONR221 MGC12-B09 BC004204 NM_024321  
HGE098354 M01C045O18 pDONR221 MGC12-B09 BC004204 NM_024321  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209506 ARiS023M18 pGCAP10 NM_024321.3  
GGGACGAAGGGGGAGAGTAGACAGCAGAACCAGCGGCGGCGGCTAAGCAGAGACTGTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl