Prev. | 

RIKEN DNA Bank Human Resource - C1orf35

Gene ID NCBI Gene 79169 |  KEGG hsa:79169
Gene Symbol C1orf35
Protein Name chromosome 1 open reading frame 35
Synonyms MMTAG2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085114 IRAL012N02 pOTB7 BC002843 NM_024319 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098035 M01C045B11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098083 M01C045D11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098131 M01C045F11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098179 M01C045H11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098227 M01C045J11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098275 M01C045L11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098323 M01C045N11 pDONR221 MGC12-C06 BC002843 NM_024319  
HGE098371 M01C045P11 pDONR221 MGC12-C06 BC002843 NM_024319  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060528 ARe51F08 pKA1U5 NM_024319.2  
GGCGGAGGCGGGGTCGGGCCTGGGTCCGACGGTAGTGGGTAGCGGGTCTCGGGTTGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl