Prev. |  KEGG KO K19873 > 

RIKEN DNA Bank Human Resource - FKRP

Gene ID NCBI Gene 79147 |  KEGG hsa:79147
Gene Symbol FKRP
Protein Name fukutin related protein
Synonyms FKTR|LGMD2I|LGMDR9|MDC1C|MDDGA5|MDDGB5|MDDGC5
Ortholog resources KEGG ortholog (KEGG orthology K19873) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081928 IRAL004N16 pOTB7 BC002612 NM_024301 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007417 W01A018J01 pENTR-TOPO IRAL004N16 BC002612 NM_024301  
HGE007419 W01A018J03 pENTR-TOPO IRAL004N16 BC002612 NM_024301  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050180 ARe25H12 pKA1U5 NM_024301.4  
GATTGCTCCAAGATGGCGGCGGCGGCGGCAGCGGGAGCGCAGCTCAGCTGGGCTGGAACT
HKR162009 ARi05A09 pGCAP10 NM_024301.4  
GATTGCTCCAAGATGGCGGCGGCGGCGGCAGCGGGAGCGCAGCTCAGCTGGGCTGGAACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl