Prev. | 

RIKEN DNA Bank Human Resource - PPDPF

Gene ID NCBI Gene 79144 |  KEGG hsa:79144
Gene Symbol PPDPF
Protein Name pancreatic progenitor cell differentiation and proliferation factor
Synonyms C20orf149|dJ697K14.9|exdpf
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047863 IRAK119K23 pCMV-SPORT6 BC056416 NM_024299 Full
HGY081860 IRAL004K20 pOTB7 BC002531 NM_024299

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000561 W01A001G17 pENTR-TOPO IRAL004K20 BC002531 NM_024299  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046808 ARe17A08 pKA1U5 NM_024299.2  
ATCCTGTATGACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTG
HKR052881 ARe32D09 pKA1U5 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGATCTTCTCTGCAAATGGG
HKR065751 ARe64G07 pKA1U5 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR178556 ARi46G12 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR187700 ARi69E04 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR234383 ARiS085P23 pGCAP10 NM_024299.2  
HKR238625 ARiS096J09 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR247214 ARiS118A14 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR322176 RBb05H08 pKA1U5 NM_024299.2  
GCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGCTC
HKR332450 RBb31C02 pGCAP1 NM_024299.2  
HKR342010 RBb55A10 pGCAP1 NM_024299.2  
TTGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGCTCCGTGGCCT
HKR347636 RBb69B12 pGCAP1 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR363276 RBd08D04 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC
HKR382170 RBd55H02 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCNNNNTNNTCTGCAAATGGGC
HKR393723 RBd84F03 pGCAP10 NM_024299.2  
GACCCCGCGCGCGCCTCTCTGTCGTGGCGCGGCTTCCCGCGGTCTTCTCTGCAAATGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl