Prev. | 

RIKEN DNA Bank Human Resource - CCDC28B

Gene ID NCBI Gene 79140 |  KEGG hsa:79140
Gene Symbol CCDC28B
Protein Name coiled-coil domain containing 28B
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082325 IRAL005N13 pOTB7 BC002462 NM_024296 Full
HGY090177 IRAL025H09 pOTB7 BC022848 NM_024296 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100046 M01C050B22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100094 M01C050D22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100142 M01C050F22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100190 M01C050H22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100238 M01C050J22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100286 M01C050L22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100334 M01C050N22 pDONR221 MGC14-H11 BC002462 NM_024296  
HGE100382 M01C050P22 pDONR221 MGC14-H11 BC002462 NM_024296  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368005 RBd20A05 pGCAP10 NM_024296.3  
GAGGAGAGGGCGGAGGGCGGAGGGAACTTGCACCGAAGCATCACTCGAGACCCCAAACCT
HKR406357 RBdS015O21 pGCAP10 NM_024296.3  
GACCCGGTGGTGTTCCCGGGAGGAGAGGGCGGAGGGCGGAGGGAACTTGCACCGAAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl