Prev. | 

RIKEN DNA Bank Human Resource - RETREG2

Gene ID NCBI Gene 79137 |  KEGG hsa:79137
Gene Symbol RETREG2
Protein Name reticulophagy regulator family member 2
Synonyms C2orf17|FAM134A|MAG-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056098 IRAK140E02 pCMV-SPORT6 BC064950 NM_024293 Partial/var
HGY082163 IRAL005G19 pOTB7 BC002420 NM_024293 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176977 ARi42H09 pGCAP10 NM_024293.4  
GTCCGCCTGACGCGCCCCCGGCGGCGGCCGCGCAGCCCTGGCTCCTCGCGGGCTCGGGCG
HKR378830 RBd47B06 pGCAP10 NM_024293.4  
GTCCGCCTGACGCGCCCCCGGCGGCGGCCGCGCAGCCCTGGCTCCTCGCGGGCTCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl