Prev. | 

RIKEN DNA Bank Human Resource - APOO

Gene ID NCBI Gene 79135 |  KEGG hsa:79135
Gene Symbol APOO
Protein Name apolipoprotein O
Synonyms FAM121B|MIC26|MICOS26|Mic23|My025
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084772 IRAL011P12 pOTB7 BC002333 NM_024122
HGY090898 IRAL027E02 pOTB7 BC010102 NM_024122 Full
HGY093011 IRAL032I19 pDNR-LIB BC016814 NM_024122 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163780 ARi09H12 pGCAP10 NM_024122.2  
GGACCCTGCCGGAGCCTCCGCTGCCAGCGACATGTTCAAGGTAATTCAGAGGTCCGTGGG
HKR345276 RBb63D04 pGCAP1 NM_024122.2  
GACCCTGCCGGAGCCTCCGCTGCCAGCGACATGTTCAAGGTAATTCAGAGGTCCGTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl