Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFAF5

Gene ID (NCBI) 79133
Gene Symbol NDUFAF5
Protein Name NADH:ubiquinone oxidoreductase complex assembly factor 5
Synonyms C20orf7|bA526K24.2|dJ842G6.1
Databases KEGG hsa:79133 |  NCBI Gene 79133
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18162)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX069788 IRAK174H20 pCMV-SPORT6 BC073158 NM_001039375 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320980 RBb02H12 pKA1U5 NM_024120.3  
GAGGGCTCTGGCGCTTATGTCGGCGACCTTGGGCGGCGAGGGTCCCAGCGGAGAATCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.02

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl