Prev. |  KEGG KO K20410 > 

RIKEN DNA Bank Human Resource - MAPKAP1

Gene ID NCBI Gene 79109 |  KEGG hsa:79109
Gene Symbol MAPKAP1
Protein Name MAPK associated protein 1
Synonyms JC310|MIP1|SIN1|SIN1b|SIN1g
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  MAPKAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081073 IRAL002L09 pOTB7 BC002326 NM_024117 Full
HGY083839 IRAL009J23 pOTB7 BC003044 NM_024117 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015277 W01A038D05 pENTR-TOPO IRAL002L09 BC003044 NM_024117  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172051 ARi30C03 pGCAP10 NM_024117.3  
GGTGTGACTGGAGCCCTAGGGTGAAGTAGATCGTGGTGANANTGAAGCTCTGGGGGANAC
HKR364546 RBd11G02 pGCAP10 NM_024117.3  
GCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGGCCGGCCGGCGGCGGCGAGC
HKR366409 RBd16A09 pGCAP10 NM_024117.3  
CGGCCGGCCGATGGTGGTTCCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGG
HKR370833 RBd27B09 pGCAP10 NM_024117.3  
GGGGGTGTGGTTCCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGGCCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl