Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAPKAP1

Gene ID (NCBI) 79109
Gene Symbol MAPKAP1
Protein Name mitogen-activated protein kinase associated protein 1
Synonyms JC310|MIP1|SIN1|SIN1b|SIN1g
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081073 IRAL002L09 pOTB7 BC002326 NM_024117 Full
HGY083839 IRAL009J23 pOTB7 BC003044 NM_024117 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015277 W01A038D05 pENTR-TOPO IRAL002L09 BC003044 NM_024117  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172051 ARi30C03 pGCAP10 NM_024117.3  
GGTGTGACTGGAGCCCTAGGGTGAAGTAGATCGTGGTGANANTGAAGCTCTGGGGGANAC
HKR364546 RBd11G02 pGCAP10 NM_024117.3  
GCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGGCCGGCCGGCGGCGGCGAGC
HKR366409 RBd16A09 pGCAP10 NM_024117.3  
CGGCCGGCCGATGGTGGTTCCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGG
HKR370833 RBd27B09 pGCAP10 NM_024117.3  
GGGGGTGTGGTTCCGGGTCGTGTGCGGCTCGGGGTAATAGGGCTGCTGCTCGGCCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl