Prev. |  KEGG KO K13221 > 

RIKEN DNA Bank Human Resource - WDR77

Gene ID NCBI Gene 79084 |  KEGG hsa:79084
Gene Symbol WDR77
Protein Name WD repeat domain 77
Synonyms HKMT1069|MEP-50|MEP50|Nbla10071|p44|p44/Mep50
Ortholog resource in our bank

  WDR77

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008122 IRAK020F02 pCMV-SPORT6 BC016946 NM_024102
HGY080827 IRAL002B03 pOTB7 BC001679 NM_024102 Full
HGY083829 IRAL009J13 pOTB7 BC006477 NM_024102 Full
HGY085275 IRAL013D03 pOTB7 BC009411 NM_024102 Partial
HGY091018 IRAL027J02 pOTB7 BC011778 NM_024102 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234166 ARiS085G22 pGCAP10 NM_024102.2  
GGGTGCACCACGTGGGGTTTGCTGCCGGAGCTGAGTCTCCGGCCGGCGTCCAGTTTGAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl