Prev. |  KEGG KO K14822 > 

RIKEN DNA Bank Human Resource - CCDC86

Gene ID NCBI Gene 79080 |  KEGG hsa:79080
Gene Symbol CCDC86
Protein Name coiled-coil domain containing 86
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K14822) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081801 IRAL004I09 pOTB7 BC001378 NM_024098 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167374 ARi18H06 pGCAP10 NM_024098.3  
GACCGGCTGAGCCATGGATACACCGTTAAGGCGCAGCCGACGGCTGGGAGGCCTAAGGCC
HKR169610 ARi24A10 pGCAP10 NM_024098.3  
GACCGGCTGAGCCATGGATACACCGTTAAGGCGCAGCCGACGGCTGGGAGGCCTAAGGCC
HKR248934 ARiS122F14 pGCAP10 NM_024098.3  
GAGGCGCCGGTTTCGGCGGGGGCTGCACGTGCGCAGGGGTGTGGAAACTTACCGGCTGAG
HKR364501 RBd11E05 pGCAP10 NM_024098.3  
GTCGGCGGGGGCTGCACGTGCGCAGGGGTGTGGAAACTTACCGGCTGAGCCATGGATACA
HKR405570 RBdS013P10 pGCAP10 NM_024098.3  
GGGGCTGCACGTGCGCAGGGGTGTGGAAACTTACCGGCTGAGCCATGGATACACCGTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl