Prev. | 

RIKEN DNA Bank Human Resource - C1orf50

Gene ID NCBI Gene 79078 |  KEGG hsa:79078
Gene Symbol C1orf50
Protein Name chromosome 1 open reading frame 50
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081098 IRAL002M10 pOTB7 BC001508 NM_024097 Full
HGY083506 IRAL008M18 pOTB7 BC001711 NM_024097

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097618 M01C044A18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097666 M01C044C18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097714 M01C044E18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097762 M01C044G18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097810 M01C044I18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097858 M01C044K18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097906 M01C044M18 pDONR221 MGC11-F09 BC001711 ENST00000372525  
HGE097954 M01C044O18 pDONR221 MGC11-F09 BC001711 ENST00000372525  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366904 RBd17E08 pGCAP10 NM_024097.2  
GAGGATAAGGCGCTGTCATGGAGGACGCCGCCGCGCCGGGGCGGACCGAGGGGGTCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl