Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATG9A

Gene ID (NCBI) 79065
Gene Symbol ATG9A
Protein Name autophagy related 9A
Synonyms APG9L1|MGD3208|mATG9
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Autophagy (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17907)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083112 IRAL007M24 pOTB7 BC001098 NM_024085 Partial/var
HGY086829 IRAL017B05 pOTB7 BC021202 NM_024085 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160827 ARi02B03 pGCAP10 NM_024085.3  
GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC
HKR068127 ARe70F07 pKA1U5 NM_024085.3  
GGCCTGGGGCCGGGCGACCCTGGGGCGAGGTGGACTNCGGTCCACGGNTCGCCGCGGCTG
HKR430343 RBdS075O07 pGCAP10 NM_024085.3  
GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl