RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ATG9A

Gene ID	NCBI Gene 79065 \| KEGG hsa:79065
Gene Symbol	ATG9A
Protein Name	autophagy related 9A
Synonyms	APG9L1\|MGD3208\|mATG9
Featured content	Autophagy (human)
Featured content	Mitophagy - human

Link

Ortholog resource in our bank

ATG9A

External database

human ATG9A

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB19627	pMXs-puro-RFP-ATG9A	Retroviral vector for stable expression of human ATG9A with N-terminal RFP.

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY083112	IRAL007M24	pOTB7	BC001098	NM_024085	Partial/var
HGY086829	IRAL017B05	pOTB7	BC021202	NM_024085	Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR068127	ARe70F07	pKA1U5	NM_024085.3
HKR068127	GGCCTGGGGCCGGGCGACCCTGGGGCGAGGTGGACTNCGGTCCACGGNTCGCCGCGGCTG
HKR160827	ARi02B03	pGCAP10	NM_024085.3
HKR160827	GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC
HKR430343	RBdS075O07	pGCAP10	NM_024085.3
HKR430343	GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl