Prev. |  KEGG KO K17907 > 

RIKEN DNA Bank Human Resource - ATG9A

Gene ID NCBI Gene 79065 |  KEGG hsa:79065
Gene Symbol ATG9A
Protein Name autophagy related 9A
Synonyms APG9L1|MGD3208|mATG9
Featured content Autophagy (human)
Ortholog resource in our bank

  ATG9A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19627 pMXs-puro-RFP-ATG9A Retroviral vector for stable expression of human ATG9A with N-terminal RFP.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083112 IRAL007M24 pOTB7 BC001098 NM_024085 Partial/var
HGY086829 IRAL017B05 pOTB7 BC021202 NM_024085 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068127 ARe70F07 pKA1U5 NM_024085.3  
GGCCTGGGGCCGGGCGACCCTGGGGCGAGGTGGACTNCGGTCCACGGNTCGCCGCGGCTG
HKR160827 ARi02B03 pGCAP10 NM_024085.3  
GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC
HKR430343 RBdS075O07 pGCAP10 NM_024085.3  
GAGACACCCGGCCTAGCGCCGCGGGTCGCGCCGAGCCGAGCCGAGCCGAGCGGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.10.11

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl