Prev. | 

RIKEN DNA Bank Human Resource - TMEM223

Gene ID NCBI Gene 79064 |  KEGG hsa:79064
Gene Symbol TMEM223
Protein Name transmembrane protein 223
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005261 IRAK013C13 pCMV-SPORT6 BC008643 XM_938324 Partial/var
HGX025731 IRAK064F11 pCMV-SPORT6 BC035565 XM_938324 Partial
HGY036549 IRAK091G05 pBluescript BC042801 XM_938324 Partial/var
HGY082512 IRAL006E16 pOTB7 BC001204 NM_001080501.3 Partial
HGY095020 IRAL037J04 pDNR-LIB BC020914 XM_938324 Full
HGY103414 IRAL058I22 pOTB7 BC071957 NM_001080501.3 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169680 ARi24D08 pGCAP10 NM_001080501.2  
AAGTCGGCTGGCCATGGCGGCGCCTTGGAGGCGATGGCCCACGGGGCTGCTAGCCGTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl