Prev. |  KEGG KO K03849 > 

RIKEN DNA Bank Human Resource - ALG8

Gene ID NCBI Gene 79053 |  KEGG hsa:79053
Gene Symbol ALG8
Protein Name ALG8 alpha-1,3-glucosyltransferase
Synonyms CDG1H|PCLD3
Ortholog resource in our bank

  ALG8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081309 IRAL003E13 pOTB7 BC001133 NM_024079 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222256 ARiS055K16 pGCAP10 NM_024079.4  
TGGCCGCAGCAATGGCGGCGCTCACAATTGCCACGGGTACTGGCAATTGGTTTTCGGCTT
HKR348004 RBb70A04 pGCAP1 NM_024079.4  
AAGTTGGTGGGAAGCGTGCGGTGCCGCAGCAATGGCGGCGCTCACAATTGCCACGGGTAC
HKR348856 RBb72C08 pGCAP1 NM_024079.4  
GGCGGTGCCGCAGCAATGGCGGCGCTCACAATTGCCACGGGTACTGGCAATTGGTTTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl