Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOC4L

Gene ID (NCBI) 79050
Gene Symbol NOC4L
Protein Name nucleolar complex associated 4 homolog (S. cerevisiae)
Synonyms NET49|NOC4|UTP19
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082583 IRAL006H15 pOTB7 BC001191 NM_024078
HGY088137 IRAL020F17 pOTB7 BC007893 NM_024078 Partial
HGY103548 IRAL058O12 pOTB7 BC071958 NM_024078 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE097216 M01C043A16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097264 M01C043C16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097312 M01C043E16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097360 M01C043G16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097408 M01C043I16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097456 M01C043K16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097504 M01C043M16 pDONR221 MGC11-B08 BC001191 ENST00000330579
HGE097552 M01C043O16 pDONR221 MGC11-B08 BC001191 ENST00000330579

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE015476 W01A038L12 pENTR-TOPO IRAL006H15 BC001191 NM_024078
HGE015478 W01A038L14 pENTR-TOPO IRAL006H15 BC001191 NM_024078
HGE015480 W01A038L16 pENTR-TOPO IRAL006H15 BC001191 NM_024078

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR080860 ARf02C12 pKA1U5 NM_024078.1
GGAGAATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGA
HKR364855 RBd12C07 pGCAP10 NM_024078.1
GGCTGAGAATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCG
HKR396077 RBd90D05 pGCAP10 NM_024078.1
GATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGAGTTC
HKR428347 RBdS070O11 pGCAP10 NM_024078.1
GGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGAGTTCGCCGGGCTCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl