Prev. |  KEGG KO K14771 > 

RIKEN DNA Bank Human Resource - NOC4L

Gene ID NCBI Gene 79050 |  KEGG hsa:79050
Gene Symbol NOC4L
Protein Name nucleolar complex associated 4 homolog
Synonyms NET49|NOC4|UTP19
Ortholog resource in our bank

  NOC4L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082583 IRAL006H15 pOTB7 BC001191 NM_024078
HGY088137 IRAL020F17 pOTB7 BC007893 NM_024078 Partial
HGY103548 IRAL058O12 pOTB7 BC071958 NM_024078 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097216 M01C043A16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097264 M01C043C16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097312 M01C043E16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097360 M01C043G16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097408 M01C043I16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097456 M01C043K16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097504 M01C043M16 pDONR221 MGC11-B08 BC001191 ENST00000330579  
HGE097552 M01C043O16 pDONR221 MGC11-B08 BC001191 ENST00000330579  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015476 W01A038L12 pENTR-TOPO IRAL006H15 BC001191 NM_024078  
HGE015478 W01A038L14 pENTR-TOPO IRAL006H15 BC001191 NM_024078  
HGE015480 W01A038L16 pENTR-TOPO IRAL006H15 BC001191 NM_024078  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080860 ARf02C12 pKA1U5 NM_024078.1  
GGAGAATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGA
HKR364855 RBd12C07 pGCAP10 NM_024078.1  
GGCTGAGAATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCG
HKR396077 RBd90D05 pGCAP10 NM_024078.1  
GATCCGCGTTGTTCCGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGAGTTC
HKR428347 RBdS070O11 pGCAP10 NM_024078.1  
GGTGTTGGGGGCGGCATGGAGCGGGAGCCGGGCGCCGCGGGAGTTCGCCGGGCTCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl