Prev. | 

RIKEN DNA Bank Human Resource - ZFYVE21

Gene ID NCBI Gene 79038 |  KEGG hsa:79038
Gene Symbol ZFYVE21
Protein Name zinc finger FYVE-type containing 21
Synonyms HCVP7TP1|ZF21
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081213 IRAL003A13 pOTB7 BC001130 NM_024071 Full
HGY088615 IRAL021I23 pDNR-LIB BC005999 NM_024071

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176010 ARi40A10 pGCAP10 NM_024071.2  
GGGGCCGGGTGCGGGGCCGCTGGCCGAGAGGCTGAGGCGGCGTCATGTCCTCCGAGGTGT
HKR243729 ARiS109F09 pGCAP10 NM_024071.2  
GGAGGGGCCGGGTGCGGGGCCGCTGGCCGAGAGGCTGAGGCGGCGTCATGTCCTCCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl