Prev. | 

RIKEN DNA Bank Human Resource - NABP2

Gene ID NCBI Gene 79035 |  KEGG hsa:79035
Gene Symbol NABP2
Protein Name nucleic acid binding protein 2
Synonyms OBFC2B|SOSS-B1|SSB1|hSSB1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080877 IRAL002D05 pOTB7 BC001079 NM_024068
HGY087538 IRAL018O02 pOTB7 BC006171 NM_024068 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338481 RBb46D09 pGCAP1 NM_024068.3  
HKR388170 RBd70H02 pGCAP10 NM_024068.3  
GAGCGGCGTGCACAGTCCTGCCGGCTGGCTTGGTGGGGTGCCGAGGCTCAGGCAGCATGA
HKR433566 RBdS083P06 pGCAP10 NM_024068.3  
GGCACTCCCGCGTTCCACGGGGCAGCATCCGGCGGCAGCGGAGCCTGTGGCTCCCCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl