Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NABP2

Gene ID (NCBI) 79035
Gene Symbol NABP2
Protein Name nucleic acid binding protein 2
Synonyms OBFC2B|SOSS-B1|SSB1|hSSB1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080877 IRAL002D05 pOTB7 BC001079 NM_024068
HGY087538 IRAL018O02 pOTB7 BC006171 NM_024068 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR338481 RBb46D09 pGCAP1 NM_024068.3
HKR388170 RBd70H02 pGCAP10 NM_024068.3
GAGCGGCGTGCACAGTCCTGCCGGCTGGCTTGGTGGGGTGCCGAGGCTCAGGCAGCATGA
HKR433566 RBdS083P06 pGCAP10 NM_024068.3
GGCACTCCCGCGTTCCACGGGGCAGCATCCGGCGGCAGCGGAGCCTGTGGCTCCCCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl