Prev. | 

RIKEN DNA Bank Human Resource - SPATA5L1

Gene ID NCBI Gene 79029 |  KEGG hsa:79029
Gene Symbol SPATA5L1
Protein Name spermatogenesis associated 5 like 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001521 IRAK003N09 pCMV-SPORT6 BC000981 NM_024063
HGX044348 IRAK110O12 pCMV-SPORT6 BC051861 NM_024063 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377628 RBd44B04 pGCAP10 NM_024063.1  
GAATCTGGTTTCGTCTGCCTGGTTCATCTGTGTGCGATGGCTCCGGACTCGGATCCCTTC
HKR432609 RBdS081I17 pGCAP10 NM_024063.1  
GGACGCTNGAGACCGGGGCACCCAGCGCTGCCGCCTGGGCCCGGCCGCCCTCCACGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl