Prev. | 

RIKEN DNA Bank Human Resource - ZNF655

Gene ID NCBI Gene 79027 |  KEGG hsa:79027
Gene Symbol ZNF655
Protein Name zinc finger protein 655
Synonyms VIK|VIK-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017124 IRAK042N12 pCMV-SPORT6 BC024770 NM_001009957
HGX031934 IRAK079N22 pCMV-SPORT6 BC037407 NM_001009957 Partial
HGX054230 IRAK135J14 pCMV-SPORT6 BC063478 NM_001009957 Full
HGY091223 IRAL028A23 pOTB7 BC011816 NM_001009957

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011063 W01A027K23 pENTR-TOPO flj0005m01 AK057245 NM_001009957  
HGE019493 W01A048M05 pENTR-TOPO flj0061p01 AK027114 NM_001009957  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074810 ARe87A10 pKA1U5 NM_024061.3  
GACCGAGAAGCGCCGGCCTCGGGGCTGTCTACAGCGGCCCGGGAGAGGCTGTGGTGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl