Prev. |  KEGG KO K00682 > 

RIKEN DNA Bank Human Resource - GGCT

Gene ID NCBI Gene 79017 |  KEGG hsa:79017
Gene Symbol GGCT
Protein Name gamma-glutamylcyclotransferase
Synonyms C7orf24|CRF21|GCTG|GGC
Ortholog resource in our bank

  GGCT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082350 IRAL005O14 pOTB7 BC000625 NM_024051
HGY086688 IRAL016L24 pDNR-LIB BC005356 NM_024051 Full/var
HGY092491 IRAL031D19 pDNR-LIB BC019243 NM_024051 Full
HGY092642 IRAL031K02 pDNR-LIB BC013937 NM_024051 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052553 ARe31G09 pKA1U5 NM_024051.2  
ACTGCGCCGGGGTAGTGGGCCCCAGTGTTGCGCCTCTCTGGCCGTTCCTTACACTTTGCT
HKR208110 ARiS020E14 pGCAP10 NM_024051.2  
GCCTGACTCGACCGGCCCACGCTTCCCGCCAGTCCCCTAACCCTGAGGCTGCCGCGCGGC
HKR323703 RBb09E07 pKA1U5 NM_024051.2  
GCCCGCCAGTCCCCTAACCCTGAGGCTGCCGCGCGGCGGTCACTGCGCCGGGGTAGTGGG
HKR441756 RBdS104G12 pGCAP10 NM_024051.2 done
GAACCCTGAGGCTGCCGCGCGGCGGTCACTGCGCCGGGGTAGTGGGCCCCAGTGTTGCGC
HKR474863 RBdS187C15 pGCAP10 NM_024051.2  
GGAGGCTGCCGCGCGGCGGTCACTGCGCCGGGGTAGTGGGCCCCAGTGTTGCGCTCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl