Prev. |  KEGG KO K11792 > 

RIKEN DNA Bank Human Resource - DDA1

Gene ID NCBI Gene 79016 |  KEGG hsa:79016
Gene Symbol DDA1
Protein Name DET1 and DDB1 associated 1
Synonyms C19orf58|PCIA1
Ortholog resource in our bank

  DDA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082246 IRAL005K06 pOTB7 BC000615 NM_024050 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100026 M01C050B02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100074 M01C050D02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100122 M01C050F02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100170 M01C050H02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100218 M01C050J02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100266 M01C050L02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100314 M01C050N02 pDONR221 MGC14-H01 BC000615 NM_024050  
HGE100362 M01C050P02 pDONR221 MGC14-H01 BC000615 NM_024050  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406133 RBdS015F13 pGCAP10 NM_024050.4  
GGCCGTGGCTGGAAGTTACTGTGAGGCGGCGGCTAAGAAGGCGGCTCTGGTGGCGGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl