Prev. | 

RIKEN DNA Bank Human Resource - LINC01260

Gene ID NCBI Gene 79015 |  KEGG hsa:79015
Gene Symbol LINC01260
Protein Name long intergenic non-protein coding RNA 1260
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001942 IRAK004O06 pCMV-SPORT6 BC000849 XM_938022 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091625 M01C029B01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091673 M01C029D01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091721 M01C029F01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091769 M01C029H01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091817 M01C029J01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091865 M01C029L01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091913 M01C029N01 pDONR221 MGC04-C01 BC000849 XM_926767  
HGE091961 M01C029P01 pDONR221 MGC04-C01 BC000849 XM_926767  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058036 ARe45B12 pKA1U5 NR_034104.1  
GCCCTTCTGCCATGTGAGGACACACAGAAGTCACCATCTATAAGAAACAGGCTCCCACCA
HKR329305 RBb23E09 pGCAP1 NR_034104.1  
TTTTTTTTTTTTTTTTTTTTGCCCTTCTGCCATGGTGAGGACACACAGAAGTCACCATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl