Prev. |  KEGG KO K15078 > 

RIKEN DNA Bank Human Resource - SLX1B

Gene ID NCBI Gene 79008 |  KEGG hsa:79008
Gene Symbol SLX1B
Protein Name SLX1 homolog B, structure-specific endonuclease subunit
Synonyms GIYD2
Ortholog resource in our bank

  SLX1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001799 IRAK004I07 pCMV-SPORT6 BC000803 -
HGY081177 IRAL002P17 pOTB7 BC000754 NM_178044
HGY082803 IRAL007A03 pOTB7 BC015990 -
HGY083950 IRAL009O14 pOTB7 BC019306 -
HGY101649 IRAL054C01 pOTB7 BC069007 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080931 ARf02F11 pKA1U5 NM_024044.2  
GGCCTCCAGACAGGAGAGGGGCACGTACCGGCGCTACGGCTTCCTGCAGGCTGCCTCCGG
HKR169634 ARi24B10 pGCAP10 NM_024044.2  
GGCACGTACCGGCGCTACGGCTTCCTGCAGGCTGCCTCCGGATAGTCCCCGAGAGCTTGT
HKR178830 ARi47B06 pGCAP10 NM_024044.2  
GCTTCTACACCCGCCTCCAGACAGGAGAGGGGCACGTACCGGCGCTACGGCTTCCTGCAG
HKR277631 ARiS194B07 pGCAP10 NM_024044.2  
GAGGCTGCCTCCGGATAGTCCCCGAGAGCTTGTTCCGAAGCAAGCACCCTGCAGCCCTAG
HKR333779 RBb34H11 pGCAP1 NM_024044.2  
TGGAGTCTGGCTTCCGCGGTCGGACTTCTACACCCGCCTCCAGACAGGAGAGGGGCACGT
HKR442086 RBdS105D14 pGCAP10 NM_024044.2  
GCGCGGTCGGACTTCTACNCCCNCCTCCAGACAGGAGAGGGGCACGTACCGGCGCTACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl