Prev. | 

RIKEN DNA Bank Human Resource - CUEDC2

Gene ID NCBI Gene 79004 |  KEGG hsa:79004
Gene Symbol CUEDC2
Protein Name CUE domain containing 2
Synonyms C10orf66|bA18I14.5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082423 IRAL006A23 pOTB7 BC000262 NM_024040

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054803 ARe37A03 pKA1U5 NM_024040.2  
GGTTGGTGGGGCTGGGGGATGAGAGCTGCACCCCTCGGNACAAGCCGCCGGCAGCGCCNT
HKR186107 ARi65E11 pGCAP10 NM_024040.2  
GGATGAGAGCTGCACCGCGCGGGACAAGTCGCCGGCGGCGCCCGACGGAGCAGAAGAGAG
HKR277617 ARiS194A17 pGCAP10 NM_024040.2  
GAGCTGCACCGCGCGNNACAANTCGCCGGCGGCGCCCGACGGAGCAGGTAAAATGTG
HKR365751 RBd14G07 pGCAP10 NM_024040.2  
GGAGAGCTGCACCGCGCGGGACAAGTCGCCGGCGGCGCCCGACGGAGCAGAAGAGAGAGC
HKR376548 RBd41G04 pGCAP10 NM_024040.2  
GGCTCTGGGCCCCGCCTTTGATCTCGTTGGTGGGGCTGGGGGATGAGAGCTGCACCGCGC
HKR433435 RBdS083J19 pGCAP10 NM_024040.2  
GGANAGCTGCACCGCGCGGGACAAGTCGCCGGCGGCGCCCGACGGAGCAGGTAAAATGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl