Prev. |  KEGG KO K17525 > 

RIKEN DNA Bank Human Resource - CHID1

Gene ID NCBI Gene 66005 |  KEGG hsa:66005
Gene Symbol CHID1
Protein Name chitinase domain containing 1
Synonyms GL008|SI-CLP|SICLP
Ortholog resources KEGG ortholog (KEGG orthology K17525) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007670 IRAK019C22 pCMV-SPORT6 BC013642 NM_023947 Partial/var
HGY083045 IRAL007K05 pOTB7 BC000001 NM_023947 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048876 ARe22D04 pKA1U5 NM_023947.2  
GACTTCCGGCGCGCTGGAGCGTTTTCCGGCCGCGNTTTTTGTGGCCGTCCGGCCTCCCTG
HKR053369 ARe33H01 pKA1U5 NM_023947.2  
GGGCCTCCCTGACATGCAGCCCTCTGGACCCCGAGGTTTGGACCCTACTGTGACACACCT
HKR163683 ARi09D11 pGCAP10 NM_023947.2  
GGGCCGTGCGTTTGTGGCCGTCCGGCCTCCCTGACATGCAGCCCTCTGGACCCCGAGGTT
HKR180480 ARi51D08 pGCAP10 NM_023947.2  
GGTGGCCGTCCGGCCTCCCTGACATGCAGATTTCCACCCAGAAGACAGAGAAGGAGCCAG
HKR277663 ARiS194C15 pGCAP10 NM_023947.2  
GCGTGCGTTTGTGGCCGTCCGGCCTCCCTGACATGCAGCCCTCTGGACCCCGAGGTTGGA
HKR345331 RBb63F11 pGCAP1 NM_023947.2  
GGTGCGTTTGTGGCCGTCCGGCCTCCCTGACATGCAGATTTCCACCCAGAAGACAGAGAA
HKR409101 RBdS022M13 pGCAP10 NM_023947.2  
GGTGTGGCCGTCCGGCCTCCCTGACATGCAGCCCTCTGGACCCCGAGGTTGGACCCTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl