Prev. | 

RIKEN DNA Bank Human Resource - C11orf95

Gene ID NCBI Gene 65998 |  KEGG hsa:65998
Gene Symbol C11orf95
Protein Name chromosome 11 open reading frame 95
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082257 IRAL005K17 pOTB7 BC000572
HGY100216 IRAL050I24 pOTB7 BC065479

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322928 RBb07F08 pKA1U5 NM_001144936.1  
GGCCGAGCGAGCAGCCTGCCGTCCGTGCGGCCNGNCGCCCCGATGCATGCGCCCCGCGCC
HKR387612 RBd69A12 pGCAP10 NM_001144936.1  
GAGGAATCCCCACCCCGGTCCAGCCCGCGCCGCCGAGCGAGCAGCCTGCCGTCCGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl