Prev. |  KEGG KO K17412 > 

RIKEN DNA Bank Human Resource - MRPS34

Gene ID NCBI Gene 65993 |  KEGG hsa:65993
Gene Symbol MRPS34
Protein Name mitochondrial ribosomal protein S34
Synonyms COXPD32|MRP-S12|MRP-S34|MRPS12
Ortholog resource in our bank

  MRPS34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082654 IRAL006K14 pOTB7 BC001182 NM_023936

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097212 M01C043A12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097260 M01C043C12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097308 M01C043E12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097356 M01C043G12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097404 M01C043I12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097452 M01C043K12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097500 M01C043M12 pDONR221 MGC11-B06 BC001182 NM_023936  
HGE097548 M01C043O12 pDONR221 MGC11-B06 BC001182 NM_023936  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR398436 RBd96B12 pGCAP10 NM_023936.1  
GGAGGACGCGGACCCGCCATGGCGCGGAAGAAGGTGCGTCCGCGGCTGATCGCGGAGCTG
HKR420550 RBdS051G06 pGCAP10 NM_023936.1  
GGCGGACCCGCCATGGCGCGGAAGAAGGTGCGTCCGCGGCTGATCGCGGAGCTGGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl