Prev. | 

RIKEN DNA Bank Human Resource - FUNDC2

Gene ID NCBI Gene 65991 |  KEGG hsa:65991
Gene Symbol FUNDC2
Protein Name FUN14 domain containing 2
Synonyms DC44|HCBP6|HCC3|PD03104
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069975 IRAK174P15 pCMV-SPORT6 BC072685 -
HGY082642 IRAL006K02 pOTB7 BC000255 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088428 M01C021B04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088476 M01C021D04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088524 M01C021F04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088572 M01C021H04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088620 M01C021J04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088668 M01C021L04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088716 M01C021N04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE088764 M01C021P04 pDONR221 IMS03-D02 BC000255 ENST00000327891  
HGE097219 M01C043A19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097267 M01C043C19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097315 M01C043E19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097363 M01C043G19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097411 M01C043I19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097459 M01C043K19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097507 M01C043M19 pDONR221 MGC11-A10 BC000255 ENST00000327891  
HGE097555 M01C043O19 pDONR221 MGC11-A10 BC000255 ENST00000327891  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334097 RBb35E01 pGCAP1 NM_023934.3  
GGCTCACCGAAAATGGCCGCGTCCAGTCAAGGAAACTTTGAGGGAAATTTTGAGTCACTG
HKR348084 RBb70D12 pGCAP1 NM_023934.3  
GCTCGCGAGACAAGCTCACCGAAATGGCCGCGTCCAGTCAAGGAAACTTTGAGGGAAATT
HKR365355 RBd13G11 pGCAP10 NM_023934.3  
GGTGACACCGCACGCTGAGCTCTGTGATGTAGCCGCTTGCGGAGACTGCAAGCAGCCGCG
HKR371634 RBd29B10 pGCAP10 NM_023934.3  
GCTGCGCACGCGCATCTCGGTGCATCTGTTGGGCGGGACCGCGGGGCCTGTGACACCGCA
HKR470810 RBdS177A10 pGCAP10 NM_023934.3  
GGCGAGACAAGCTCACCGAAATGGCCGCGTCCAGTCAAGGAAACTTTGAGGGAAATTTTG
HKR475164 RBdS187P04 pGCAP10 NM_023934.3  
GATCTGTTGGGCGGGACCGCGGGGCCTGTGACACCGCACGCTGAGCTCTGTGATGTAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl