Prev. | 

RIKEN DNA Bank Human Resource - ANTKMT

Gene ID NCBI Gene 65990 |  KEGG hsa:65990
Gene Symbol ANTKMT
Protein Name adenine nucleotide translocase lysine methyltransferase
Synonyms ANT-KMT|C16orf24|FAM173A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082489 IRAL006D17 pOTB7 BC001181 NM_023933
HGY084805 IRAL012A05 pOTB7 BC002624 NM_023933 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097224 M01C043A24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097272 M01C043C24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097320 M01C043E24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097368 M01C043G24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097416 M01C043I24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097464 M01C043K24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097512 M01C043M24 pDONR221 MGC11-B12 BC001181 ENST00000219535  
HGE097560 M01C043O24 pDONR221 MGC11-B12 BC001181 ENST00000219535  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077611 ARe94A11 pKA1U5 NM_023933.1  
GAGGCTCTGCCGGCCACTTCCGGTGTCGCGCGGCGGCTCCCGGCAGGAGGGAGAGGGCAC
HKR326927 RBb17F07 pKA1U5 NM_023933.1  
GACTTCCGGTGTCGCGCGGCGGCTCCCGGCAGGAGGGAGAGGGCACACCGCCAGCCCCAG
HKR393278 RBd83D06 pGCAP10 NM_023933.1  
GGTCGCGCGGCGGCTCCCGGCAGGAGGGAGAGGGCACACCGCCAGCCCCAGGCCAGGCTG
HKR408944 RBdS022F24 pGCAP10 NM_023933.1  
GACTTCCGGTGTCGCGCGGCGGCTCCCGGCAGGAGGGAGAGGGCACACCGCCAGCCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl