Prev. |  KEGG KO K01907 > 

RIKEN DNA Bank Human Resource - AACS

Gene ID NCBI Gene 65985 |  KEGG hsa:65985
Gene Symbol AACS
Protein Name acetoacetyl-CoA synthetase
Synonyms ACSF1|SUR-5
Ortholog resource in our bank

  AACS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019458 IRAK048K18 pBluescriptR BC040490 NM_023928 Full/var
HGX044155 IRAK110G11 pCMV-SPORT6 BC051862 NM_023928 Full
HGY083736 IRAL009F16 pOTB7 BC004997 NM_023928 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052401 ARe31A01 pKA1U5 NM_023928.3  
GAGTCCCTTGNTTCCCCGCCGCCGCCGTCGCTGACCCAGCCCGCCAGGCGCTCCTGACCG
HKR058475 ARe46D03 pKA1U5 NM_023928.3  
GCTTGTTCCCCGCCGCCGCCGTCGCTGACCCAGCCCGCCAGGCGCTCCTGACCGTCGCTT
HKR218204 ARiS045I12 pGCAP10 NM_023928.3  
GCCCTTGTTCCCCGCCGCCGCCGTCGCTGACCCAGCCCGCCAGGCGCTCCTGACCGTCGC
HKR393732 RBd84F12 pGCAP10 NM_023928.3  
GCCCTTGTTCCCCGCCGCCGCCGTCGCTGACCCAGCCCGCCAGGCGCTCCTGACCGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl