Prev. |  KEGG KO K09230 > 

RIKEN DNA Bank Human Resource - ZSCAN18

Gene ID NCBI Gene 65982 |  KEGG hsa:65982
Gene Symbol ZSCAN18
Protein Name zinc finger and SCAN domain containing 18
Synonyms ZNF447
Ortholog resource in our bank

  ZSCAN18

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04535 SEREX clone NGO-Co-9 (ID 2244) #1 SEREX clone NGO-Co-9 (ID 2244) #1
RDB04827 SEREX clone NGO-Pr-143 (ID 2509) #1 SEREX clone NGO-Pr-143 (ID 2509) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084493 IRAL011D21 pOTB7 BC006205 NM_023926 Partial/var
HGY090034 IRAL025B10 pOTB7 BC022846 NM_023926
HGY095310 IRAL038E14 pDNR-LIB BC017411 NM_023926 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018636 W01A046J20 pENTR-TOPO IRAL025B10 BC022846 NM_023926  
HGE018640 W01A046J24 pENTR-TOPO IRAL025B10 BC022846 NM_023926  
HGE018666 W01A046L02 pENTR-TOPO IRAL025B10 BC022846 NM_023926  
HGE018670 W01A046L06 pENTR-TOPO IRAL025B10 BC022846 NM_023926  
HGE018672 W01A046L08 pENTR-TOPO IRAL025B10 BC022846 NM_023926  
HGE018678 W01A046L14 pENTR-TOPO IRAL025B10 BC022846 NM_023926  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123658 ARh09C10 pGCAP1 NM_023926.4  
GCCCAGTGCGCAGGCGCAGTTTGCCGGCCGCCATCGCGCACTGGGGCTCCGGGCGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl